The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1294
Genome IDAE009439
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanopyrus kandleri AV19 [AE009439]
Start position on genome 55068
End posion on genome 55221
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
cctcgggaac
tRNA gene sequence
GGGCCCGCGGTGTAGCCAGGTCTATCATGCGGGGCTCCAGACCCCGTGACCCGGGTTCAA
ATCCCGGCGGGCCCACCA
Downstream region at tRNA end position
aggcccaaat
Secondary structure (Cloverleaf model)
>At1294	Trp	CCA
                   c      ACCA aggcccaaat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    C     G G C C C     A
    C C G A        G      | | | | |     A
  A         T G T G       C C G G G     C
  G           | | +                 T T
  G         T C A T
    T C T A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGCGGTGTAGCCAGGTCTATCATGCGGGGCTCCAGggacccgccgatgacttcca
tggggtgtgccggacctggtggggagacccctggagcgacgaggcgggtcgaagacACCC
CGTGACCCGGGTTCAAATCCCGGCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK