Sequence ID | >WENV170440024 |
Genome ID | CEUV01065520 |
Search identical group | |
Phylum/Class | [CEUV] marine metagenome genome assembly TARA_123_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2285 |
End posion on genome | 2212 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ggagaagatT |
tRNA gene sequence |
TCCTCAGTAGCTCAGGGGTAGAGCGGTCGGCTGTTAACCGGTTTGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
agttgcatca |
Secondary structure (Cloverleaf model) | >WENV170440024 Asn GTT T GGga agttgcatca T - A C - G C - G T + G C - G A - T G - C T A T C A T C C A G A A | | | | | A G C T C G G T A G G C G | | | | T T G G A G C T A G TTGTC G + T T + G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |