Sequence ID | >WENV170442711 |
Genome ID | CEUW01061893 |
Search identical group | |
Phylum/Class | [CEUW] marine metagenome genome assembly TARA_122_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 190 |
End posion on genome | 263 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gttacaatat |
tRNA gene sequence |
ACGGGTGTAGCTCAATTGGTAGAGTAGTGGTCTCCAAAACCATTGGCTGGGAGTTCGAGT |
Downstream region at tRNA end position |
taatgataaa |
Secondary structure (Cloverleaf model) | >WENV170442711 Trp CCA t GCgt taatgataaa A - T C - G G - C G - C G - C T - A G - C T G T C T C T C A T A A A | + | | | G T C T C G G G G A G C G | | | + T T G G A G T T A A TGGCT G + T T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |