Sequence ID | >WENV170443729 |
Genome ID | CEUX01007055 |
Search identical group | |
Phylum/Class | [CEUX] marine metagenome genome assembly TARA_123_MIX_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1191 |
End posion on genome | 1115 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ctctttcggt |
tRNA gene sequence |
CGGTGTGTAGCGCAGCCTGGTAGCGCACTGTCATGGGGTGTCAGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
acttctctct |
Secondary structure (Cloverleaf model) | >WENV170443729 Pro GGG t ACCA acttctctct C - G G - C G - C T - A G - C T - A G - C T A T T C T C C A C G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A G - C T T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |