The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1337
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 799925
End posion on genome 800106
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
gcccgcttaa
tRNA gene sequence
GGGGCTGTGGCCTAGCCAGGTAGGGCGACGGGCTCCAGACCCGTCGATCGTGCGTTCGAA
TCGCACCAGCCCCAcct
Downstream region at tRNA end position
ttctgacggc
Secondary structure (Cloverleaf model)
>At1337	Trp	CCA
                   a      Acct ttctgacggc
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     C A C G C     A
      C G A        G      | | | | |     G
    C       T C C G       G T G C G     C
    A       + | | |                 T T
    G       G G G C
      G T A        G     CGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGCTGTGGCCTAGCCAGGTAGGGCGACGGGCTCCAGcggtatgactggatgatgagca
acgggtctgctgagccatcccgacggggatggtgttgatgatccgttggagcactgagat
gatcatgtgttctcagaatcggagagACCCGTCGATCGTGCGTTCGAATCGCACCAGCCC
CA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK