Sequence ID | >WENV170445166 |
Genome ID | CEUY01023295 |
Search identical group | |
Phylum/Class | [CEUY] marine metagenome genome assembly TARA_123_MIX_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 3776 |
End posion on genome | 3703 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
accaagtttt |
tRNA gene sequence |
GCGGGTATAGCATAGTGGTAATGCTCTAGCCTTCCAAGCTAGCTAGGGGGGTTCGATTCC |
Downstream region at tRNA end position |
atttaaaact |
Secondary structure (Cloverleaf model) | >WENV170445166 Gly TCC t TCCA atttaaaact G - C C - G G - C G - C G - C T - A A - T T T T C C C C C A G A A | | | | | G T T A C G G G G G G C G | | | | T T G A T G C T A T CTAG C - G T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |