| Sequence ID | >WENV170457422 |
| Genome ID | CEVA01418128 |
| Phylum/Class | [CEVA] marine metagenome genome assembly TARA_125_SRF_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
560
|
|
End posion on genome
|
487
|
|
Amino Acid
|
Cys
|
|
Anticodon
|
GCA
|
|
Upstream region at tRNA start position
|
gcttgcaaat
|
|
tRNA gene sequence
|
GGCATCGTGGCCGAGTGGCTAGGCACAGCTCTGCAAAAGCTTGTACAGCGGTTCGAATCC GCTCGATGCCTCAA
|
|
Downstream region at tRNA end position
|
aacccagtac
|
| Secondary structure (Cloverleaf model) | >WENV170457422 Cys GCA
t TCAA aacccagtac
G - C
G - C
C - G
A - T
T - A
C - G
G - C T A
T T C G C C A
G A G | | | | | G
T G C C G A G C G G C
G | | | T T
G A G G C
C T A GTAC
C T
A - T
G - C
C - G
T - A
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |