The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1486
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 1909530
End posion on genome 1909339
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
tccttgtaaa
tRNA gene sequence
GGGGCTGTGGCCTAGCCCGGCATGGCGATGGGCTCCAGACCCGTCGATCGTGAGTTCGAA
TCTCACCAGCCCCAcgt
Downstream region at tRNA end position
tttttcttta
Secondary structure (Cloverleaf model)
>At1486	Trp	CCA
                   a      Acgt tttttcttta
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     C A C T C     A
      C G A        G      | | | | |     G
    C       T C C G       G T G A G     C
    C         | | |                 T T
    G       T G G C
      G C A        G     CGATC
                    A - T
                    T + G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGCTGTGGCCTAGCCCGGCATGGCGATGGGCTCCAGcggataaatgatgaacaacggg
tatactgaatctttcccgacggggcaagataatgaggaaccgttggagcactgatagatg
ctcaccagaaaactgtataagcagttgttcggagatACCCGTCGATCGTGAGTTCGAATC
TCACCAGCCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK