Sequence ID | >WENV170464370 |
Genome ID | CEVD01209024 |
Search identical group | |
Phylum/Class | [CEVD] marine metagenome genome assembly TARA_123_MIX_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 54 |
End posion on genome | 128 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tcgagaccgg |
tRNA gene sequence |
TGGGGTATGGTGTAATTGGCAACACGGCTGATTCTGGTTCAGTTGTTCTTGGTTCGAGTC |
Downstream region at tRNA end position |
gagaaacccg |
Secondary structure (Cloverleaf model) | >WENV170464370 Gln CTG g GCAA gagaaacccg T - A G - C G - C G - C G - C T - A A - T T G T G G A C C A T A A G | + | | | G T T G T G C T T G G C G | | | | T T G A C A C C A G TGTT G + T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |