The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1592
Genome IDCP000102
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosphaera stadtmanae DSM 3091 [CP000102]
Start position on genome 1696551
End posion on genome 1696409
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
tagcacatat
tRNA gene sequence
GGGGTTATAGTGTAACCTGGCATCATCTGGGACTCCAGATCCTAGGATCGGGGTTCAAAT
CCCTGTGACCCCAttt
Downstream region at tRNA end position
tttaaaaaaa
Secondary structure (Cloverleaf model)
>At1592	Trp	CCA
                   t      Attt tttaaaaaaa
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     T + G
                     A - T          T A
                    T     G T C C C     A
      C A A        A      | + | | |     A
    C       T G T G       C G G G G     C
    T         | | +                 T T
    G       T C A T
      G C A        C     GGAT
                    T - A
                    G + T
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGTTATAGTGTAACCTGGCATCATCTGGGACTCCAGttgtctttgaagaacgcgcgca
tgctgaggcataccgatgatgatcgattggagtgctgagacaagagaaATCCTAGGATCG
GGGTTCAAATCCCTGTGACCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK