Sequence ID | >WENV170471637 |
Genome ID | CEVG01090135 |
Search identical group | |
Phylum/Class | [CEVG] marine metagenome genome assembly TARA_140_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 238 |
End posion on genome | 162 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcaaaaatgt |
tRNA gene sequence |
GCGTCCTTAGCTCAGTTGGTTAGAGCGCTGCCTTGACATGGCAGAGGTCGGTAGTTCGAG |
Downstream region at tRNA end position |
cttttctaag |
Secondary structure (Cloverleaf model) | >WENV170471637 Val GAC t ACCA cttttctaag G - C C - G G - C T - A C - G C - G T - A T G T T C A T C A T G A A + | | | | G T C T C G G G T A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |