The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1723
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 1620543
End posion on genome 1620363
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
agagaggtga
tRNA gene sequence
GGGGACGTGGCCAAGCCAGGCATGGCGACTGACTCCAGATCAGTCGATCGGGGGTTCAAA
TCCCTCCGTCCCCAtac
Downstream region at tRNA end position
aactgcttcg
Secondary structure (Cloverleaf model)
>At1723	Trp	CCA
                   a      Atac aactgcttcg
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     C - G
                     G - C          T A
                    T     C T C C C     A
      C G A        G      | + | | |     A
    C       A C C G       G G G G G     C
    A       | | | |                 T T
    G       T G G C
      G C A        G     CGATC
                    A - T
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGACGTGGCCAAGCCAGGCATGGCGACTGACTCCAGaggccacgcgcccggtgacgag
actccagactgatataccgagcggacggctgatcaccgcttccgcgttgacgaccctctg
gaggaccgaggcgcataccggagatATCAGTCGATCGGGGGTTCAAATCCCTCCGTCCCC
A
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK