Sequence ID | >WENV170482752 |
Genome ID | CEVM01056807 |
Search identical group | |
Phylum/Class | [CEVM] marine metagenome genome assembly TARA_145_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 676 |
End posion on genome | 600 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgagctctga |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
attttcaaca |
Secondary structure (Cloverleaf model) | >WENV170482752 Met CAT a ACCA attttcaaca T T G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |