Sequence ID | >At1781 |
Genome ID | AL096836 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Pyrococcus abyssi [AL096836] |
Start position on genome | 296677 |
End posion on genome | 296753 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgagtgagtg |
tRNA gene sequence |
GCCGGGGTGGTGTAGCCTGGTTAGCACAGGGGACTGTGGATCCCCTAGCCCGGGTTCAAA |
Downstream region at tRNA end position |
gaaaagaact |
Secondary structure (Cloverleaf model) | >At1781 His GTG g CCCA gaaaagaact G - C C - G C - G G - C G - C G - C G - C T A T G G C C C A C C G A G | | | | | A T T G T G C C G G G C G + | | | T T G G C A C T T A A TAGC G - C G - C G - C G - C A - T C A T G G T G |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGGGTGGTGTAGCCTGGTTAGCACAGGGGACTGTGGATCCCCTAGCCCGGGTTCAAA |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |