Sequence ID | >WENV170488060 |
Genome ID | CEVO01117804 |
Search identical group | |
Phylum/Class | [CEVO] marine metagenome genome assembly TARA_152_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2926 |
End posion on genome | 2851 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccgcgaaagt |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCACATCATTCGTAATGATGGGGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
ttcacggccg |
Secondary structure (Cloverleaf model) | >WENV170488060 Thr CGT t ACCA ttcacggccg G - C C - G C - G G - C C - G T - A T - A T G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |