Sequence ID | >WENV170491851 |
Genome ID | CEVQ01100574 |
Search identical group | |
Phylum/Class | [CEVQ] marine metagenome genome assembly TARA_148b_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 211 |
End posion on genome | 284 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ggacagctga |
tRNA gene sequence |
TGCCCCGTCGTCTAATGGTAAGACTGCGGACTCTGACTCCGTCAATTGAGGTTCGAATCC |
Downstream region at tRNA end position |
ttctcccaac |
Secondary structure (Cloverleaf model) | >WENV170491851 Gln CTG a TCCA ttctcccaac T - A G - C C - G C - G C - G C - G G - C T A T A C T C C A A A C | | | | | G T T C T G T G A G G C G | | | | T T G A G A C T A T CAAT G + T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |