Sequence ID | >WENV170496077 |
Genome ID | CEVS01021649 |
Search identical group | |
Phylum/Class | [CEVS] marine metagenome genome assembly TARA_151_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 239 |
End posion on genome | 315 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ggacgtatca |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCACCGTGTTGATAACGCGGGGGTCAGTGGTTCGAG |
Downstream region at tRNA end position |
ttattaatgt |
Secondary structure (Cloverleaf model) | >WENV170496077 Ile GAT a ACCA ttattaatgt G - C G - C G - C T - A C - G T - A G + T T G T T C A C C A C G A A | | | | | G T C T C G A G T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C T + G G - C T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |