The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1880
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 597231
End posion on genome 597379
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
ttaatcgagt
tRNA gene sequence
GGGGGCGTGGTGTAGCCTGGTCCATCATCGCGGGCTCCAGACCCGCGGACCGGGGTTCAA
ATCCCCGCGCCCCCACCA
Downstream region at tRNA end position
agtttttact
Secondary structure (Cloverleaf model)
>At1880	Trp	CCA
                   t      ACCA agtttttact
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T A
                    T     G C C C C     A
    C C G A        G      | | | | |     A
  T         T G T G       C G G G G     C
  G           | | +                 T T
  G         T C A T
    T C C A        C     GGAC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGGCGTGGTGTAGCCTGGTCCATCATCGCGGGCTCCAGaggccatgaggataggcggg
tttgctgacctcggggcgtgatgaacctttggagccccgagggccggagaaACCCGCGGA
CCGGGGTTCAAATCCCCGCGCCCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK