Sequence ID | >WENV170498777 |
Genome ID | CEVT01071754 |
Search identical group | |
Phylum/Class | [CEVT] marine metagenome genome assembly TARA_150_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 166 |
End posion on genome | 80 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atcagtttga |
tRNA gene sequence |
GCGGGGATCGCCTAGCCCGGTATGGCGTGGGATTGCTAATCCCATGTTCGCAAGAACTCG |
Downstream region at tRNA end position |
gctttaatat |
Secondary structure (Cloverleaf model) | >WENV170498777 Ser GCT a GCCA gctttaatat G - C C - G G - C G - C G - C G - C A - T T G T C T C C C A C G A C | + | | | A C T C C G G G G G G C C | | | T T G T G G C G T A G TGTTCGCAAGAACTC T - A G - C G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |