The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1936
Genome IDAP006878
Search identical group
Phylum/ClassEuryarchaeota
SpeciesThermococcus kodakarensis KOD1 [AP006878]
Start position on genome 1945687
End posion on genome 1945826
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
actcccggac
tRNA gene sequence
GGGGGCGTGGTGTAGCCTGGTCCATCATCGCGGGCTCCAGACCCGCGGACCGGGGTTCAA
ATCCCCGCGCCCCCACCA
Downstream region at tRNA end position
catcagccct
Secondary structure (Cloverleaf model)
>At1936	Trp	CCA
                   c      ACCA catcagccct
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T A
                    T     G C C C C     A
    C C G A        G      | | | | |     A
  T         T G T G       C G G G G     C
  G           | | +                 T T
  G         T C A T
    T C C A        C     GGAC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGGCGTGGTGTAGCCTGGTCCATCATCGCGGGCTCCAGaggtatgaggacttgcgggt
ttactgattggggatgagcctttggagctctgacccggagaaACCCGCGGACCGGGGTTC
AAATCCCCGCGCCCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK