| Sequence ID | >WENV170503765 |
| Genome ID | CEVV01128688 |
| Phylum/Class | [CEVV] marine metagenome genome assembly TARA_152_MIX_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
1756
|
|
End posion on genome
|
1667
|
|
Amino Acid
|
Ser
|
|
Anticodon
|
TGA
|
|
Upstream region at tRNA start position
|
gcttctaaaa
|
|
tRNA gene sequence
|
GGAGAGATGGCTGAGCGGTTGAAAGCACCGGTCTTGAAAACCGGCAAAGGGGCAACTCTT TCCTGGGTTCGAATCCCAGTCTCTCCGCCA
|
|
Downstream region at tRNA end position
|
tcatttctca
|
| Secondary structure (Cloverleaf model) | >WENV170503765 Ser TGA
a GCCA tcatttctca
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T G A C C C A
C G A G | | | | | G
G G T C G C T G G G C
G | | | T T
T A A G C
T G A A CAAAGGGGCAACTCTTTC
C - G
C - G
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |