Sequence ID | >WENV170507812 |
Genome ID | CEVX01094139 |
Search identical group | |
Phylum/Class | [CEVX] marine metagenome genome assembly TARA_152_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 162 |
End posion on genome | 248 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cggcttaatt |
tRNA gene sequence |
GCCCAGGTGGCGAAATTGGTAGACGCAAGGGACTTAAAATCCCTCGGTAGAAATACTGTG |
Downstream region at tRNA end position |
aatattaata |
Secondary structure (Cloverleaf model) | >WENV170507812 Leu TAA t ACCA aatattaata G - C C - G C - G C - G A - T G - C G - C T C T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGGTAGAAATACTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |