The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2084
Genome IDAM114193
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocella arvoryzae MRE50 [AM114193]
Start position on genome 215398
End posion on genome 215150
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
ttcgcacgca
tRNA gene sequence
GGGGTTGTGGCCAAGCCAGGTATGGCGACGGGCTCCAGACCCGTCGATCAGGAGTTCAAA
TCTCTTCAACCCCAcct
Downstream region at tRNA end position
tcttttatta
Secondary structure (Cloverleaf model)
>At2084	Trp	CCA
                   a      Acct tcttttatta
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     T - A
                     G - C          T A
                    T     T T C T C     A
      C G A        G      | + | | |     A
    C       A C C G       A G G A G     C
    A       | | | |                 T T
    G       T G G C
      G T A        G     CGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGTTGTGGCCAAGCCAGGTATGGCGACGGGCTCCAGcggtggaagggtctgataggcc
ctccagaaatatgatgagcaacgggtcacctgaagctgcccgacggggtagcttgtgagg
aaccgttggagcgctgatttcaaagcgttccccgcgcgtcaatcgcgcaggagcgccgct
ctctggtgaaatcccagacaatcaatcggagagACCCGTCGATCAGGAGTTCAAATCTCT
TCAACCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK