Sequence ID | >WENV170519716 |
Genome ID | CEWE01254470 |
Search identical group | |
Phylum/Class | [CEWE] marine metagenome genome assembly TARA_124_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 3582 |
End posion on genome | 3506 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
catcacccac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
tataccgaaa |
Secondary structure (Cloverleaf model) | >WENV170519716 Arg ACG c GCCA tataccgaaa G - C C - G G - C C - G C - G C - G G - C T A T C G T G C A C G A A | | | | | G T C T C G G C A C G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |