Sequence ID | >WENV170522062 |
Genome ID | CEWG01063209 |
Search identical group | |
Phylum/Class | [CEWG] marine metagenome genome assembly TARA_102_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 118 |
End posion on genome | 193 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ctcaaatgtt |
tRNA gene sequence |
GGTGCCTTAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCCCTGGTTCGATT |
Downstream region at tRNA end position |
tctaaaaagc |
Secondary structure (Cloverleaf model) | >WENV170522062 Phe GAA t ACCA tctaaaaagc G - C G - C T - A G - C C - G C - G T - A T T T G G T C C A T G A A | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T T - A G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |