The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2132
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 120790
End posion on genome 120719
Amino Acid Ala
Anticodon TGC
Upstream region at tRNA start position
tacaacctct
tRNA gene sequence
GGGCCCGTAGTCCAGCGGTAGGACGCCGCCCTTGCAAGGCGGAGGCCCCGGGTTCGAATC
CCGGCGGGTCCActa
Downstream region at tRNA end position
tttggatttc
Secondary structure (Cloverleaf model)
>At2132	Ala	TGC
                   t      Acta tttggatttc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     G
      C     C C T G       C C G G G     C
      G     | | | |                 T T
      G     G G A C
        T A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGTCCAGCGGTAGGACGCCGCCCTTGCAAGGCGGAGGCCCCGGGTTCGAATC
CCGGCGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK