The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2209
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 882087
End posion on genome 882174
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
cgtcccccga
tRNA gene sequence
GCCGGGGTGCCCGAGCCTGGCCAAAGGGGTCGGGCTTAGGACCCGATGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCGGCACCA
Downstream region at tRNA end position
aggagctccc
Secondary structure (Cloverleaf model)
>At2209	Leu	TAG
                   a      ACCA aggagctccc
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
    C C G A        G      | | | | |     A
  T         G C C C       G T G G G     C
  G           | | |                 T T
  G         A G G G
    C C A A        G     TGGCGTAGGCCTGC
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGCCCGAGCCTGGCCAAAGGGGTCGGGCTTAGGACCCGATGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCGGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK