The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2282
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 175851
End posion on genome 176046
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
gcaaggttgc
tRNA gene sequence
GGGGCTGTGGCCTAGCCTGGAATGGCGACGGGCTCCAGACCCGTCGATCGAGAGTTCGAA
TCTCTCCAGCCCCAcat
Downstream region at tRNA end position
tttactttta
Secondary structure (Cloverleaf model)
>At2282	Trp	CCA
                   c      Acat tttactttta
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     C T C T C     A
      C G A        G      | | | | |     G
    C       T C C G       G A G A G     C
    T         | | |                 T T
    G       T G G C
      G A A        G     CGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGCTGTGGCCTAGCCTGGAATGGCGACGGGCTCCAGcggataaatgatgaacaacggg
tctactgagatctgctcgacggagtgggtcggtgaagagccgttggagcactgatgtgtg
ttcttaagaattgactgtcgtaaggcagttgttcggagagACCCGTCGATCGAGAGTTCG
AATCTCTCCAGCCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK