Sequence ID | >WENV170529828 |
Genome ID | CEWJ01167211 |
Search identical group | |
Phylum/Class | [CEWJ] marine metagenome genome assembly TARA_128_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 532 |
End posion on genome | 461 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
nnnnnnggct |
tRNA gene sequence |
GCGGGTGTAATTCAGCGGTAGAATGTCAGCTTCCCAAGCTGAACGTCGCCGGTTCAAATC |
Downstream region at tRNA end position |
atttgttatt |
Secondary structure (Cloverleaf model) | >WENV170529828 Gly CCC t Ttgt atttgttatt G - C C - G G - C G - C G - C T - A G - C T A T T G G C C A G A A + | | | | A C C T T A G C C G G C G | | | | T T G G A A T T A G ACGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |