Sequence ID | >WENV170534026 |
Genome ID | CEWO01183019 |
Search identical group | |
Phylum/Class | [CEWO] marine metagenome genome assembly TARA_145_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1426 |
End posion on genome | 1351 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tttcatgagt |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGAGTTCGACT |
Downstream region at tRNA end position |
ttatttcatt |
Secondary structure (Cloverleaf model) | >WENV170534026 Thr TGT t ACCA ttatttcatt G - C C - G C - G G - C G - C T + G A - T T C T G G T T C A T G A A | | + | | G T C T C G C C G A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |