Sequence ID | >WENV170535050 |
Genome ID | CEWP01019828 |
Search identical group | |
Phylum/Class | [CEWP] marine metagenome genome assembly TARA_067_SRF_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 4326 |
End posion on genome | 4250 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tatttcgtga |
tRNA gene sequence |
GGGCTCGTAGCTCAGCTGGATAGAGCACCTCCCTTCTAAGGAGGCGGTCATAGGTTCGAA |
Downstream region at tRNA end position |
aagtaaatgc |
Secondary structure (Cloverleaf model) | >WENV170535050 Arg TCT a ACAA aagtaaatgc G - C G + T G - C C - G T + G C - G G - C T A T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C A T A A CGGTC C - G C - G T - A C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |