Sequence ID | >WENV170539110 |
Genome ID | CEWR01150219 |
Search identical group | |
Phylum/Class | [CEWR] marine metagenome genome assembly TARA_085_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2479 |
End posion on genome | 2564 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttatgtata |
tRNA gene sequence |
GGGGACGTGGTGGAATTGGTAGACACGACGGACTTAAAATCCGTTGCCTAGTGATAGGCG |
Downstream region at tRNA end position |
tttaattcta |
Secondary structure (Cloverleaf model) | >WENV170539110 Leu TAA a Atta tttaattcta G - C G - C G - C G - C A - T C - G G + T T G T C T C C C A T A A G | | | | | A T G G T G G A G G G C G | | | T T G A C A C T A G G TGCCTAGTGATAGGCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |