Sequence ID | >WENV170540509 |
Genome ID | CWHD01000025 |
Search identical group | |
Phylum/Class | [CWHD] human gut metagenome; ENVO:feces |
Species | |
Start position on genome | 15574 |
End posion on genome | 15498 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tttgcaccat |
tRNA gene sequence |
CGGGCCGTAGCGCAGTTTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
attagccccg |
Secondary structure (Cloverleaf model) | >WENV170540509 Pro GGG t ACCG attagccccg C - G G - C G - C G - C C - G C - G G - C T A T C G C C C A T G A A | | | | | A T C G C G G C G G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |