| Sequence ID | >WENV170540512 |
| Genome ID | CWHD01000035 |
| Phylum/Class | [CWHD] human gut metagenome; ENVO:feces |
| Species | |
| Start position on genome | 15547 |
| End posion on genome | 15473 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
tgtcatttgc |
| tRNA gene sequence |
GGGCAATTAGCTCAGTTGGTTAGAGCGCCACCTTTACACGGTGGATGTCGGGGGTTCGAG |
| Downstream region at tRNA end position |
tcatttttca |
| Secondary structure (Cloverleaf model) | >WENV170540512 Val TAC
c ACtt tcatttttca
G - C
G - C
G - C
C - G
A - T
A - T
T - A T G
T C T C C C A
T G A A | + | | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
T T A G ATGTC
C - G
C - G
A - T
C - G
C - G
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |