Sequence ID | >WENV170540587 |
Genome ID | CWHE01000192 |
Search identical group | |
Phylum/Class | [CWHE] human gut metagenome; ENVO:feces |
Species | |
Start position on genome | 41997 |
End posion on genome | 42093 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
attttgtttc |
tRNA gene sequence |
GGGAGTGGATGGGTTCTGGTGTTCCCTCTGGTCTTCAAAACCAGTATGAGGAGTTAGGAG |
Downstream region at tRNA end position |
attaaactat |
Secondary structure (Cloverleaf model) | >WENV170540587 SeC(p) TCA c GCCA attaaactat G - C G - C G - C A - T G + T T - A G - C G A T T A C A T C C A T C T T | | | | | G G T G G G G T A G G C G | | | T T T T C C C G T T TATGAGGAGTTAGGAGCTTCTTGG C - G T - A G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |