Sequence ID | >WENV170543816 |
Genome ID | CXQZ01000021 |
Search identical group | |
Phylum/Class | [CXQZ] human gut metagenome genome assembly hE10, contig; ENVO:feces |
Species | |
Start position on genome | 26284 |
End posion on genome | 26202 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaaacagact |
tRNA gene sequence |
GGCGGATTTCCCAAGCGGTCAAAGGGAGCTGACTGTAAATCAGCCGCTTCGTGCTTCAGT |
Downstream region at tRNA end position |
cccgatagct |
Secondary structure (Cloverleaf model) | >WENV170543816 Tyr GTA t ACgc cccgatagct G - C G - C C - G G - C G - C A - T T - A T A T T C A C C A C G A T | | | | | G G A C C C A G T G G C G | | | T T T A G G G C A A A CGCTTCGTGCTTC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |