| Sequence ID | >WENV170545727 |
| Genome ID | CXSG01000002 |
| Phylum/Class | [CXSG] human gut metagenome genome assembly hH11, contig; ENVO:feces |
| Species | |
| Start position on genome | 18230 |
| End posion on genome | 18315 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
agtacggcat |
| tRNA gene sequence |
GGAGGATTCGCCTAGTGGTCTATGGCGCACGCTTGGAAAGCGTGTTGGTGTAACAGCCTC |
| Downstream region at tRNA end position |
atgccctttt |
| Secondary structure (Cloverleaf model) | >WENV170545727 Ser GGA
t GCtc atgccctttt
G - C
G - C
A - T
G - C
G - C
A - T
T - A T A
T T G C T C A
T G A C | | | | | G
G T C C G A C G A G C
G | | | T T
T T G G C
C T A G TTGGTGTAACAGCCTC
C - G
A - T
C - G
G - C
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |