Sequence ID | >WENV170547348 |
Genome ID | CXTL01000030 |
Search identical group | |
Phylum/Class | [CXTL] Human gut metagenome genome assembly, contig: mC7_contig000223.; ENVO:feces |
Species | |
Start position on genome | 69730 |
End posion on genome | 69655 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ggaatccttt |
tRNA gene sequence |
GCGGACATAGCTTAGTTGGTAAAGCGCAACCTTGCCAAGGTTGAGACCGCGGGTTCGAGT |
Downstream region at tRNA end position |
ccaaaacctc |
Secondary structure (Cloverleaf model) | >WENV170547348 Gly GCC t TCCA ccaaaacctc G - C C - G G - C G - C A - T C - G A - T T G T T G C C C A T G A A + | | | | G T T T C G G C G G G C G | | | | T T G A A G C T A G AGACC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |