Sequence ID | >WENV170547450 |
Genome ID | CXTN01000068 |
Search identical group | |
Phylum/Class | [CXTN] Human gut metagenome genome assembly, contig: mC2_contig000356.; ENVO:feces |
Species | |
Start position on genome | 22420 |
End posion on genome | 22338 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aatccggcag |
tRNA gene sequence |
GCCTCCATGGCGAAATTGGTATACGCAGTCGACTTAAAATCGACCGCTTCGGCTTACGGG |
Downstream region at tRNA end position |
tcactccccg |
Secondary structure (Cloverleaf model) | >WENV170547450 Leu TAA g ACCC tcactccccg G - C C - G C - G T - A C - G C - G A - T T G T T G C C C A T A A G | | | | | G T A G C G A C G G G C G | | | T T G A C G C T A T A CGCTTCGGCTT G - C T - A C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |