Sequence ID | >WENV170549175 |
Genome ID | CXUX01000007 |
Search identical group | |
Phylum/Class | [CXUX] Human gut metagenome genome assembly, contig: mE4_contig000425.; ENVO:feces |
Species | |
Start position on genome | 50769 |
End posion on genome | 50857 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agtacggcaT |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGTCTATGGCGCACGCTTGGAAAGCGTGTTGGTGTAACAGCCTC |
Downstream region at tRNA end position |
ggatttgaac |
Secondary structure (Cloverleaf model) | >WENV170549175 Ser GGA T GCCC ggatttgaac G - C G - C A - T G - C G - C A - T T - A T A T T G C T C A T G A C | | | | | G G T C C G A C G A G C G | | | T T T T G G C C T A G TTGGTGTAACAGCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |