Sequence ID | >WENV170549331 |
Genome ID | CXUZ01000069 |
Search identical group | |
Phylum/Class | [CXUZ] Human gut metagenome genome assembly, contig: mF10_contig000129.; ENVO:feces |
Species | |
Start position on genome | 2091 |
End posion on genome | 2166 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgcgaaccaa |
tRNA gene sequence |
GCCACTTTAGCTCAGTCGGTAGAGCGGCTCACTCGTAATGAGCAGGTCGTCAGTTCGATT |
Downstream region at tRNA end position |
acaccctagg |
Secondary structure (Cloverleaf model) | >WENV170549331 Thr CGT a TCGA acaccctagg G - C C - G C - G A - T C - G T - A T - A T T T C A G T C A T G A A | | | | | G C C T C G G T C A G C G | | | | T T G G A G C T A G AGGTC G - C C - G T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |