Sequence ID | >WENV170550249 |
Genome ID | CXVR01000738 |
Search identical group | |
Phylum/Class | [CXVR] Human gut metagenome genome assembly, contig: mG3_contig001247.; ENVO:feces |
Species | |
Start position on genome | 1247 |
End posion on genome | 1323 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aatggcgtat |
tRNA gene sequence |
CGGGCTATAGCGCAGTTTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGTGGGTTCAAA |
Downstream region at tRNA end position |
acaaaaaaag |
Secondary structure (Cloverleaf model) | >WENV170550249 Pro TGG t ACAA acaaaaaaag C - G G - C G - C G - C C - G T - A A - T T A T C G C C C A T G A A | + | | | A T C G C G G T G G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |