Sequence ID | >WENV170555861 |
Genome ID | CXWL01002626 |
Search identical group | |
Phylum/Class | [CXWL] groundwater metagenome; biofilm material |
Species | |
Start position on genome | 8785 |
End posion on genome | 8874 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggcgtcaagc |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTTAAGGCACCGGTCTTGAAAACCGGCGTGGGTTCACGCTCA |
Downstream region at tRNA end position |
ggcacgattt |
Secondary structure (Cloverleaf model) | >WENV170555861 Ser TGA c GCCA ggcacgattt G - C G - C A - T C - G A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTTCACGCTCACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |