| Sequence ID | >WENV170563382 |
| Genome ID | CZCB01016478 |
| Phylum/Class | [CZCB] anaerobic digester metagenome; anaerobic digester |
| Species | |
| Start position on genome | 5238 |
| End posion on genome | 5162 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
tttcgtcagt |
| tRNA gene sequence |
CGGGGCGTAGCTCAGTTTGGTAGAGCGCTACCTTGGGGTGGTAGAGGCCGCACGTTCAAG |
| Downstream region at tRNA end position |
ttgattttat |
| Secondary structure (Cloverleaf model) | >WENV170563382 Pro GGG
t ACCA ttgattttat
C - G
G - C
G - C
G + T
G - C
C - G
G - C T G
T T G T G C A
T G A A + | | | | A
T C T C G G C A C G C
T | | | | T T
G G A G C
G T A G AGGCC
C - G
T - A
A - T
C - G
C - G
T T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |