| Sequence ID | >WENV170567892 |
| Genome ID | FLMP01008812 |
| Phylum/Class | [FLMP] seawater metagenome; seawater |
| Species | |
| Start position on genome | 1462 |
| End posion on genome | 1389 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
gaaacgatac |
| tRNA gene sequence |
GCCACCCTAGCTCAGTTGGTAGAGCAGCTCACTCGTAACGAGCAGGTCAGGAGTTCGATT |
| Downstream region at tRNA end position |
tacgagattc |
| Secondary structure (Cloverleaf model) | >WENV170567892 Thr CGT
c TCtc tacgagattc
G - C
C - G
C - G
A - T
C - G
C - G
C - G T T
T T C C T C A
T G A A | | | | | G
T C T C G A G G A G C
G | | | | T T
G G A G C
T A A AGGTC
G - C
C - G
T - A
C - G
A C
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |