| Sequence ID | >WENV170568209 |
| Genome ID | FLMP01022467 |
| Phylum/Class | [FLMP] seawater metagenome; seawater |
| Species | |
| Start position on genome | 1456 |
| End posion on genome | 1381 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ttggccaacg |
| tRNA gene sequence |
CGGGGCGTAGCGTAGTGGCTAGCGCGCCTGCTTTGGGAGCAGGAGACCGGGAGTTCGAAT |
| Downstream region at tRNA end position |
tttgtgccgt |
| Secondary structure (Cloverleaf model) | >WENV170568209 Pro TGG
g ACCA tttgtgccgt
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C C C T C A
T G A A | | | | | G
G T G C G G G G A G C
G + | | | T T
C G C G C
T A G AGACC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |