Sequence ID | >WENV170569578 |
Genome ID | FLMP01236058 |
Search identical group | |
Phylum/Class | [FLMP] seawater metagenome; seawater |
Species | |
Start position on genome | 215 |
End posion on genome | 139 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ctaccgctat |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGCTAGAGCGCCTGCCTTGCACGCAGGAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
aactcaaatg |
Secondary structure (Cloverleaf model) | >WENV170569578 Ala TGC t ACTA aactcaaatg G - C G - C G + T G - C A - T A - T T - A T C T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |