Sequence ID | >WENV170573017 |
Genome ID | FLOH01003871 |
Search identical group | |
Phylum/Class | [FLOH] marine metagenome; water |
Species | |
Start position on genome | 48 |
End posion on genome | 124 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttaaagtatt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGCTAGAGCCTCTGCCTTCCAAGCAGATTGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
cgtttaccaa |
Secondary structure (Cloverleaf model) | >WENV170573017 Gly TCC t TCCA cgtttaccaa G - C C - G G - C G - C G - C A - T A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C C T A C TTGTC T - A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |