| Sequence ID | >WENV170574121 |
| Genome ID | FLYM01007759 |
| Phylum/Class | [FLYM] hot springs metagenome; Sediment |
| Species | |
| Start position on genome | 2881 |
| End posion on genome | 2805 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
gataactctt |
| tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCAGAAGTTCGAG |
| Downstream region at tRNA end position |
acaaaggcga |
| Secondary structure (Cloverleaf model) | >WENV170574121 Ile GAT
t ACCA acaaaggcga
G - C
G - C
G - C
C - G
C - G
T - A
G - C T G
T T C T T C A
T G A A | | | | | G
T C T C G A G A A G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |