| Sequence ID | >WENV170575578 |
| Genome ID | FPHE01000116 |
| Phylum/Class | [FPHE] hydrothermal vent metagenome genome assembly, contig: NODE_55.; water |
| Species | |
|
Start position on genome
|
24192
|
|
End posion on genome
|
24117
|
|
Amino Acid
|
Phe
|
|
Anticodon
|
GAA
|
|
Upstream region at tRNA start position
|
actacagagt
|
|
tRNA gene sequence
|
GGCTCCATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGGCGGTTCGATT CCGTCTGGCGCCACCA
|
|
Downstream region at tRNA end position
|
cttataaatt
|
| Secondary structure (Cloverleaf model) | >WENV170575578 Phe GAA
t ACCA cttataaatt
G - C
G - C
C - G
T C
C - G
C - G
A - T T T
T C T G C C A
T G A A | + | | | G
T C T C G G G C G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
A - T
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |